Video: ESSO on The Morning After with Angela Yee

This is week 2 of the Gimme A Break segment on The Morning After with Angela Yee on SHADE45, featuring comedian Patrice Oneal as a co-host. ESSO is also nominated for an Underground Music Award for the “#1 Contender”. Voting ends on August 6th, go here to cast your vote.

Previously: ESSO on Angela Yee’s show last week | ESSO – Don’t Stop (Trailer) (Video)


AddThis Social Bookmark Button

43 Responses to “Video: ESSO on The Morning After with Angela Yee”

  1. THE-XFACTA Says:

    Hell Rell looks like he should have a leash around his neck. Or at least a flea and tick collar

  2. GorillaJoe aka Chief Ali Says:

    That nigga Hell Rell face looks like special effects, on some George Lucas computer generated type shit.

  3. Mac Brown aka Drugs R bad.. so I abuse the P*ssy! Says:

    Hell Rells face registers a 6.8 on the Rictor scale!

  4. Mac Brown aka Drugs R bad.. so I abuse the P*ssy! Says:

    I bet ya’ll niggas didn’t know hell rell was previously a movie star

    tinyurl.com/mcqt76

  5. I Fux Says:

    Hell Rell is nicer on the mic and handsomer than Esso

  6. Brooklyn Strong Says:

    Hell Rell looks like the nigga in your crew that chicks always pick last
    Chicken Head voice: Why I gotta fuck with him ILLLLLLL

  7. Black Says:

    GorillaJoe aka Chief Ali Says:

    July 31st, 2009 at 2:51 pm
    That nigga Hell Rell face looks like special effects, on some George Lucas computer generated type shit.

    ^^^LMAO at the thought of Hell Rell attacking Luke Skywalker at the bar in Episode IV.

  8. Troyvul Says:

    Raptors get Bellini which is a damn good look, Colangelo is on his shit these days, after fucking up with that O’Neal fiasco last year.

  9. Taster's Choice [||] Says:

    hell rell’s face make freddie krueger look like megan fox

  10. icon (trillbert arenas) Says:

    Brooklyn Strong Says:

    July 31st, 2009 at 2:53 pm
    Hell Rell looks like the nigga in your crew that chicks always pick last
    Chicken Head voice: Why I gotta fuck with him ILLLLLLL

    ***Real talk, I had a friend, back in the day, that refused to hang out with this other friend of mine, on some “what if we meet some bitches? ain’t no hoes fucking with that, we’re all gonna lose” type ish…funny, but kinda bitchlike attitude, imo…

  11. RIGZ Says:

    They call Hell Rell’s chauffeur “The Pooper Scooper”

  12. Iceberg Slimm AKA The Gold Medalist Says:

    I put a mill on it MJ woulda traded in the Elephant Man’s bones for Hell Rell’s

  13. icon (trillbert arenas) Says:

    Hell Rell uses his razor bumps to open beer bottles

  14. Big Homie Says:

    LOL at all these Hell Rell jokes

  15. Rockabye Says:

    Hell Rell makes Sam Cassell look human.

  16. THE-XFACTA Says:

    Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.

  17. I Fux Says:

    hell rell was the illest dude who ever worked for Monsters Inc

  18. Brooklyn Strong Says:

    July 31st, 2009 at 2:50 pm
    Black Says:

    July 31st, 2009 at 2:49 pm
    i hate on Drake because he’s mad average

    ^^^I really wonder what a whole album from Drake is gonna sound like. So Far Gone is a great mixtape but an album (at least a good one) is supposed to have a theme or at least some kind of cohesion. Is this nigga just gonna hit u with rhymes about how fly he is and how many bitches he can bag?
    =====================================Drakes Album will sound like chris browns except it will have more rapping

    Leave a Reply

  19. icon (trillbert arenas) Says:

    Hell Rell shaves, by staring in the mirror until the hairs just fall out (none)

  20. Taster's Choice [||] Says:

    THE-XFACTA Says:

    July 31st, 2009 at 2:56 pm
    Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.

    ^

    *slits throat*

  21. D_block_4_life Says:

    Yeah…it was alright
    ^
    You didn’t think the way he rhymed every letter in the same sequence as it was spelled, then every letter individually wasn’t nothing short are amazing GREAT? Did you even realize he was doing that?

  22. Taster's Choice [||] Says:

    @ x facta, but see some dude love to get in the a$$ [||]

    any dudes who think it’s tasty (?)

    pause of course

  23. Mac Brown aka Drugs R bad.. so I abuse the P*ssy! Says:

    icon (trillbert arenas) Says:

    July 31st, 2009 at 2:57 pm
    Hell Rell shaves, by staring in the mirror until the hairs just fall out (none)

    ^^GAAAAAAAAATTTTTTTTTT (c) 88

  24. icon (trillbert arenas) Says:

    Rockabye Says:

    July 31st, 2009 at 2:56 pm
    Hell Rell makes Sam Cassell look human.

    ***Charles Barkley was funny, when he dropped that Lord of the Rings diss on Sam Cassell, a few years back…”he’ll do anything to get a ring….they made three movies about him trying to get the precious”

  25. I Fux Says:

    funny, but kinda bitchlike attitude, imo

    ^^^^^
    word the Homie Omar always says this shit about his brother. IM LIKE DAMN THATS FUCKED UP. Omar “HE GETS NO BITCHES AND THEN HE GETS DRUNK, NOBODY NEEDS THAT LIABILITY” ….

  26. Big Homie Says:

    Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.

    ^ I’ve done that a few times

  27. landLORD Says:

    Hell Rell’s birth Certificate says… Birthplace: Area 51

  28. GorillaJoe aka Chief Ali Says:

    It looks like Hell Rell cleans his face with lava

  29. herbal kint Says:

    SLAUGHTERHOUSE

  30. THE-XFACTA Says:

    Craig Mack looked at Hell Rell and said Got Damn You Sho Iz Ugly!

  31. Black Says:

    ***Real talk, I had a friend, back in the day, that refused to hang out with this other friend of mine, on some “what if we meet some bitches? ain’t no hoes fucking with that, we’re all gonna lose” type ish…funny, but kinda bitchlike attitude, imo…

    ^^^Yeah fam that is bitchlike for a couple reasons. 1st, ur homie should’nt give a fuck if the bitches ain’t wanna fuck wit dude cuz that should have absolutely no affect on whether or not he can put his bid in. 2nd, it’s different for ugly niggaz as opposed to ugly bitches. An ugly nigga can still pull the baddest bitches if his G is right

  32. GorillaJoe aka Chief Ali Says:

    any dudes who think it’s tasty (?)
    —————————————

    *Tries to find out what’s popping in the afterlife*

  33. landLORD Says:

    The Sun wears shades when Hell Rell comes out …

  34. icon (trillbert arenas) Says:

    Hell Rell’s face look like his arms are just long enough to box with God, and get his ass whooped….

  35. Dan. Says:

    Motown 25 and Guessing Game > DEMONS

    No shots.

  36. Mac Brown aka Drugs R bad.. so I abuse the P*ssy! Says:

    Hell Rell exfoliates with broken glass

  37. D_block_4_life Says:

    Hell Rell’s birth Certificate says… Birthplace: Area 51
    ^
    Omg

    and Cries @ a dirty penny

  38. D_block_4_life Says:

    Hell Rell exfoliates with broken glass
    ^
    Omg

  39. Taster's Choice [||] Says:

    Section 482 of the New York Criminal Code states that an in-person glance from Hell Rell can be considered misdemeanor assault punishable by 6 months in prison or up to $50,000 in fines, hence Hell Rell has to walk around New York with a court-mandated Yankee fitted with his brim low and shades on at all times so as not to commit pereptual assault against bystanders.

  40. Troyvul Says:

    Hell Rell fathered my dog.

  41. Brooklyn Strong Says:

    You Sho Iz Ugly was the funniest line in the Color purple my girl was sad and crying and I was laughing about that shit throughout the movie

  42. Barbecue Tee Says:

    Hell Rell uses his razor bumps to open beer bottles

    ^^ lol. how? why? *sighs*

  43. GMZ Says:

    # Taster’s Choice [||] Says:
    July 31st, 2009 at 3:02 pm

    Section 482 of the New York Criminal Code states that an in-person glance from Hell Rell can be considered misdemeanor assault punishable by 6 months in prison or up to $50,000 in fines, hence Hell Rell has to walk around New York with a court-mandated Yankee fitted with his brim low and shades on at all times so as not to commit pereptual assault against bystanders.
    ^^^^^^^^^^^^^^^^^^^^^^^^

    Best laugh of the day….

Leave a Reply