Video: ESSO on The Morning After with Angela Yee
This is week 2 of the Gimme A Break segment on The Morning After with Angela Yee on SHADE45, featuring comedian Patrice Oneal as a co-host. ESSO is also nominated for an Underground Music Award for the “#1 Contender”. Voting ends on August 6th, go here to cast your vote.
Previously: ESSO on Angela Yee’s show last week | ESSO – Don’t Stop (Trailer) (Video)
July 31st, 2009 at 2:51 pm
Hell Rell looks like he should have a leash around his neck. Or at least a flea and tick collar
July 31st, 2009 at 2:51 pm
That nigga Hell Rell face looks like special effects, on some George Lucas computer generated type shit.
July 31st, 2009 at 2:52 pm
Hell Rells face registers a 6.8 on the Rictor scale!
July 31st, 2009 at 2:53 pm
I bet ya’ll niggas didn’t know hell rell was previously a movie star
tinyurl.com/mcqt76
July 31st, 2009 at 2:53 pm
Hell Rell is nicer on the mic and handsomer than Esso
July 31st, 2009 at 2:53 pm
Hell Rell looks like the nigga in your crew that chicks always pick last
Chicken Head voice: Why I gotta fuck with him ILLLLLLL
July 31st, 2009 at 2:53 pm
GorillaJoe aka Chief Ali Says:
July 31st, 2009 at 2:51 pm
That nigga Hell Rell face looks like special effects, on some George Lucas computer generated type shit.
^^^LMAO at the thought of Hell Rell attacking Luke Skywalker at the bar in Episode IV.
July 31st, 2009 at 2:54 pm
Raptors get Bellini which is a damn good look, Colangelo is on his shit these days, after fucking up with that O’Neal fiasco last year.
July 31st, 2009 at 2:55 pm
hell rell’s face make freddie krueger look like megan fox
July 31st, 2009 at 2:55 pm
Brooklyn Strong Says:
July 31st, 2009 at 2:53 pm
Hell Rell looks like the nigga in your crew that chicks always pick last
Chicken Head voice: Why I gotta fuck with him ILLLLLLL
***Real talk, I had a friend, back in the day, that refused to hang out with this other friend of mine, on some “what if we meet some bitches? ain’t no hoes fucking with that, we’re all gonna lose” type ish…funny, but kinda bitchlike attitude, imo…
July 31st, 2009 at 2:56 pm
They call Hell Rell’s chauffeur “The Pooper Scooper”
July 31st, 2009 at 2:56 pm
I put a mill on it MJ woulda traded in the Elephant Man’s bones for Hell Rell’s
July 31st, 2009 at 2:56 pm
Hell Rell uses his razor bumps to open beer bottles
July 31st, 2009 at 2:56 pm
LOL at all these Hell Rell jokes
July 31st, 2009 at 2:56 pm
Hell Rell makes Sam Cassell look human.
July 31st, 2009 at 2:56 pm
Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.
July 31st, 2009 at 2:57 pm
hell rell was the illest dude who ever worked for Monsters Inc
July 31st, 2009 at 2:57 pm
July 31st, 2009 at 2:50 pm
Black Says:
July 31st, 2009 at 2:49 pm
i hate on Drake because he’s mad average
^^^I really wonder what a whole album from Drake is gonna sound like. So Far Gone is a great mixtape but an album (at least a good one) is supposed to have a theme or at least some kind of cohesion. Is this nigga just gonna hit u with rhymes about how fly he is and how many bitches he can bag?
=====================================Drakes Album will sound like chris browns except it will have more rapping
Leave a Reply
July 31st, 2009 at 2:57 pm
Hell Rell shaves, by staring in the mirror until the hairs just fall out (none)
July 31st, 2009 at 2:57 pm
THE-XFACTA Says:
July 31st, 2009 at 2:56 pm
Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.
^
*slits throat*
July 31st, 2009 at 2:58 pm
Yeah…it was alright
^
You didn’t think the way he rhymed every letter in the same sequence as it was spelled, then every letter individually wasn’t nothing short are amazing GREAT? Did you even realize he was doing that?
July 31st, 2009 at 2:58 pm
@ x facta, but see some dude love to get in the a$$ [||]
any dudes who think it’s tasty (?)
pause of course
July 31st, 2009 at 2:58 pm
icon (trillbert arenas) Says:
July 31st, 2009 at 2:57 pm
Hell Rell shaves, by staring in the mirror until the hairs just fall out (none)
^^GAAAAAAAAATTTTTTTTTT (c) 88
July 31st, 2009 at 2:58 pm
Rockabye Says:
July 31st, 2009 at 2:56 pm
Hell Rell makes Sam Cassell look human.
***Charles Barkley was funny, when he dropped that Lord of the Rings diss on Sam Cassell, a few years back…”he’ll do anything to get a ring….they made three movies about him trying to get the precious”
July 31st, 2009 at 2:58 pm
funny, but kinda bitchlike attitude, imo
^^^^^
word the Homie Omar always says this shit about his brother. IM LIKE DAMN THATS FUCKED UP. Omar “HE GETS NO BITCHES AND THEN HE GETS DRUNK, NOBODY NEEDS THAT LIABILITY” ….
July 31st, 2009 at 2:59 pm
Hell Rell looks like the face you’d have when you ate the pussy and went a little too low.
^ I’ve done that a few times
July 31st, 2009 at 2:59 pm
Hell Rell’s birth Certificate says… Birthplace: Area 51
July 31st, 2009 at 2:59 pm
It looks like Hell Rell cleans his face with lava
July 31st, 2009 at 3:00 pm
SLAUGHTERHOUSE
July 31st, 2009 at 3:00 pm
Craig Mack looked at Hell Rell and said Got Damn You Sho Iz Ugly!
July 31st, 2009 at 3:00 pm
***Real talk, I had a friend, back in the day, that refused to hang out with this other friend of mine, on some “what if we meet some bitches? ain’t no hoes fucking with that, we’re all gonna lose” type ish…funny, but kinda bitchlike attitude, imo…
^^^Yeah fam that is bitchlike for a couple reasons. 1st, ur homie should’nt give a fuck if the bitches ain’t wanna fuck wit dude cuz that should have absolutely no affect on whether or not he can put his bid in. 2nd, it’s different for ugly niggaz as opposed to ugly bitches. An ugly nigga can still pull the baddest bitches if his G is right
July 31st, 2009 at 3:00 pm
any dudes who think it’s tasty (?)
—————————————
*Tries to find out what’s popping in the afterlife*
July 31st, 2009 at 3:00 pm
The Sun wears shades when Hell Rell comes out …
July 31st, 2009 at 3:01 pm
Hell Rell’s face look like his arms are just long enough to box with God, and get his ass whooped….
July 31st, 2009 at 3:01 pm
Motown 25 and Guessing Game > DEMONS
No shots.
July 31st, 2009 at 3:01 pm
Hell Rell exfoliates with broken glass
July 31st, 2009 at 3:01 pm
Hell Rell’s birth Certificate says… Birthplace: Area 51
^
Omg
and Cries @ a dirty penny
July 31st, 2009 at 3:02 pm
Hell Rell exfoliates with broken glass
^
Omg
July 31st, 2009 at 3:02 pm
Section 482 of the New York Criminal Code states that an in-person glance from Hell Rell can be considered misdemeanor assault punishable by 6 months in prison or up to $50,000 in fines, hence Hell Rell has to walk around New York with a court-mandated Yankee fitted with his brim low and shades on at all times so as not to commit pereptual assault against bystanders.
July 31st, 2009 at 3:02 pm
Hell Rell fathered my dog.
July 31st, 2009 at 3:03 pm
You Sho Iz Ugly was the funniest line in the Color purple my girl was sad and crying and I was laughing about that shit throughout the movie
July 31st, 2009 at 3:05 pm
Hell Rell uses his razor bumps to open beer bottles
^^ lol. how? why? *sighs*
July 31st, 2009 at 7:03 pm
# Taster’s Choice [||] Says:
July 31st, 2009 at 3:02 pm
Section 482 of the New York Criminal Code states that an in-person glance from Hell Rell can be considered misdemeanor assault punishable by 6 months in prison or up to $50,000 in fines, hence Hell Rell has to walk around New York with a court-mandated Yankee fitted with his brim low and shades on at all times so as not to commit pereptual assault against bystanders.
^^^^^^^^^^^^^^^^^^^^^^^^
Best laugh of the day….