Pic: Eminem, Dr. Dre & Curtis on Video Set
For what song? I don’t know, Interscope isn’t saying. But it’s supposedly Em’s first single. I can’t believe Boo-Boo couldn’t join the bosses and put on a suit. Show some courtesy Curtis.
In related news, it was announced a short while ago that Em will be inducting Run D.M.C. into the Rock & Roll Hall of Fame during the ceremony on April 4th.
UPDATE: RapRadar has the info. The song is called “We Made You”.












March 23rd, 2009 at 3:13 pm
Curtis is hilarious.
March 23rd, 2009 at 3:15 pm
a never fucked woth em
March 23rd, 2009 at 3:15 pm
em not blonde? cant wait for him to fully emerge. this guy is such a fucking mystery.
March 23rd, 2009 at 3:15 pm
I Love Em.
March 23rd, 2009 at 3:16 pm
L Seven ass niggas.
March 23rd, 2009 at 3:16 pm
Curtis’ chip stack is smaller….subliminally being put in his place?
March 23rd, 2009 at 3:16 pm
a never fucked woth em
^^
Shut up please.
March 23rd, 2009 at 3:16 pm
why does eminem have a part in his head?
March 23rd, 2009 at 3:16 pm
Nahright stans for : Joe Budden, Cam’ron, Nikki Minaj’s box
Fixed*
No one gives 2 shits about her music
March 23rd, 2009 at 3:16 pm
em not blonde? cant wait for him to fully emerge. this guy is such a fucking mystery.
^^
Ay Fucking Yo
March 23rd, 2009 at 3:17 pm
Johnny Cadelco Says:
March 23rd, 2009 at 3:15 pm
I Love Em.
^^
Ay Fucking Yo.
What the hell is going on here?
March 23rd, 2009 at 3:17 pm
cant wait for him to fully emerge
^Holy Shit (c) ‘nard
March 23rd, 2009 at 3:17 pm
# D_Block_4_Life Says:
March 23rd, 2009 at 3:16 pm
a never fucked woth em
^^
Shut up please.
^ go swim in a shark tank
March 23rd, 2009 at 3:17 pm
a never fucked woth em
^^
Shut up please.
–Cosign
*hugs greeny*
No homo but its nice to see that em is skinny cause i heard dude was spiraling downwards after proof
March 23rd, 2009 at 3:18 pm
COCCA88CRAZY88SINCE88 Says:
March 23rd, 2009 at 3:16 pm
L Seven ass niggas.
^LOL
March 23rd, 2009 at 3:18 pm
Looks like some “Rain Man” shit… Wassup Nah..
March 23rd, 2009 at 3:19 pm
youtube.com/watch?v=hQp5l4-sfFA > crack a bottle
March 23rd, 2009 at 3:19 pm
*daps DPS*
March 23rd, 2009 at 3:19 pm
# cOLD Says:
March 23rd, 2009 at 3:16 pm
3 cops got murked in cali? wow
^ thought it was 4, two were swat
March 23rd, 2009 at 3:19 pm
No homo but its nice to see that em is skinny cause i heard dude was spiraling downwards after proof
^Gaining weight is your idea of spiraling downward? LOL.
He could be extra skinny and really spiraling if you know what I’m saying.
(I’m referencing Cocaine use)
March 23rd, 2009 at 3:19 pm
# D. Billz Says:
March 23rd, 2009 at 3:03 pm
If ninjas in the South are living a substantially financially secure life sellin’ shit outta their trunk, then it’s clear that a major was never needed. But the South actually support their artists. In that aspect, blame the fans. But the fact still remains that it can be done.
^^
Why can’t NY just do the same.
My only guess would be that due to the cost of living selling $10 CDs out your trunk still aint lucrative enough in NY. The cheaper cost of living helps keep this practice thriving.
If I sell 100 CDs in a week, Thats a G & enough to pay rent for two months. Thats enough to pay one mortgage payment on a decent house in a decent area. LMAO. in NY, That won’t even cover eating street vendor food every day.
March 23rd, 2009 at 3:19 pm
ny music got stale
============
Nah. The dumb nigga outnumber the smart niggas & dumb niggas love them some dumb, country ass music.
—————————————————————
where you getting your facts from? you honesly think if Cam called Just today for a beat, Just would say 200K? you live in a dream world.
==============================================
Just ain’t fucking with Cam like that anyway.
But I bet money he still gets $80-$100,000 a track.
March 23rd, 2009 at 3:19 pm
For what song? I don’t know, Interscope isn’t saying. But it’s supposedly Em’s first single. I can’t believe Boo-Boo couldn’t join the bosses and put on a suit. Show some courtesy Curtis.
^^Real Mungkeyss don’t wear suits
March 23rd, 2009 at 3:19 pm
Asher Roth, Wale, Charles Hamilton, Kid Cudi
all these need to get on track together..and make music…
March 23rd, 2009 at 3:19 pm
waht up party
March 23rd, 2009 at 3:20 pm
^ thought it was 4, two were swat
>To me, if he didn’t die on the scene you should get credit for the body. Yeah you killed him, but this isnt amateur hour….dead him immediately!
So 4 cops dead, 3 murdered.
March 23rd, 2009 at 3:20 pm
Damn.. It like a Tuesday morning circa 2007 Greenie, C88S88, BD. LOL
Wassup , Beezy (Phiily Standing up, but in front of a cop car and DEFINITELY not in West Philly, lol)
March 23rd, 2009 at 3:20 pm
(I’m referencing Cocaine use)
^^
Word, Em’s on a coke diet.
March 23rd, 2009 at 3:20 pm
Da PartyStarter Says:
March 23rd, 2009 at 3:18 pm
Looks like some “Rain Man” shit… Wassup Nah..
^yeah, it does kinda look like that…lol *daps DPS*
March 23rd, 2009 at 3:20 pm
To me, if he didn’t die on the scene you should get credit for the body.
^edit: shouldn’t
March 23rd, 2009 at 3:20 pm
Da PartyStarter Says:
March 23rd, 2009 at 3:18 pm
Looks like some “Rain Man” shit… Wassup Nah..
^^^
*daps Disco Stu*
March 23rd, 2009 at 3:20 pm
# Big_seth Says:
March 23rd, 2009 at 3:19 pm
# D. Billz Says:
March 23rd, 2009 at 3:03 pm
If ninjas in the South are living a substantially financially secure life sellin’ shit outta their trunk, then it’s clear that a major was never needed. But the South actually support their artists. In that aspect, blame the fans. But the fact still remains that it can be done.
^^
Why can’t NY just do the same.
My only guess would be that due to the cost of living selling $10 CDs out your trunk still aint lucrative enough in NY. The cheaper cost of living helps keep this practice thriving.
If I sell 100 CDs in a week, Thats a G & enough to pay rent for two months. Thats enough to pay one mortgage payment on a decent house in a decent area. LMAO. in NY, That won’t even cover eating street vendor food every day.
^ where is rent $500 a month?
March 23rd, 2009 at 3:21 pm
Hey Greenie!!!!
March 23rd, 2009 at 3:21 pm
First off – he’s 6’2 & a half” and BIG. He’s a former San Diego Charger. He made his screen debut with Arnold Schwarzeneggar in THE 6TH DAY. And his most recent film will be this summer’s Arnie-less TERMINATOR SALVATION. He is TERRY CREWS. Not necessarily a big name, but a big man to take his place among other big men. As I said, Sly seems very enthusiastic about this fella and I look forward to seeing what Terry Crews has in store for us.
–Im glad terry is getting some shine as a lead actor. Dude is downright hilarious
March 23rd, 2009 at 3:21 pm
Nestle Snipes Says:
March 23rd, 2009 at 3:16 pm
Joe Budden vs. Cam’ron
would be good battle…who would the stans pull for…
^KIILA easy, joey B aint got nottin on CAM
March 23rd, 2009 at 3:21 pm
Nahright stans for : Joe Budden, Cam’ron, Nikki Minaj’s box,GUCCI
Fixed
March 23rd, 2009 at 3:21 pm
Joe Budden vs. Cam’ron
would be good battle…who would the stans pull for…
March 23rd, 2009 at 3:21 pm
Word, Em’s on a coke diet.
^I hope he isn’t on the Charles Hamilton diet (coke & semen)
March 23rd, 2009 at 3:21 pm
take a good look at Dr Dre, nigga face look like he got the LL treatment. Compared to that last pic of Dre that was posted, he looks a lot younger.
March 23rd, 2009 at 3:21 pm
Da PartyStarter Says:
March 23rd, 2009 at 3:20 pm
Damn.. It like a Tuesday morning circa 2007
^LOL…right?
March 23rd, 2009 at 3:21 pm
Crack a bottle..
March 23rd, 2009 at 3:22 pm
Eminem looks healthy and fine in that picture…Glad to see that he is no longer battling that pill addiction/depression.
March 23rd, 2009 at 3:22 pm
y em looklike pee wee herman
March 23rd, 2009 at 3:22 pm
Yeah you killed him, but this isnt amateur hour….dead him immediately!
^^
That sounds like an Uncle Murda adlib, lol.
March 23rd, 2009 at 3:22 pm
Everybody woddle…
March 23rd, 2009 at 3:22 pm
C88S88,BD, SC,B-Ease and the rest “Wassup?”
*Daps and church hugs…Daps and Church hugs…*
March 23rd, 2009 at 3:22 pm
^Gaining weight is your idea of spiraling downward? LOL.
He could be extra skinny and really spiraling if you know what I’m saying.
(I’m referencing Cocaine use)
–lol na, i mean they said he was taking pills, excessively eating, went to the hospital for something weight related.
March 23rd, 2009 at 3:22 pm
Killa Vs. Curtis is unfinished buisness IMO.
Crtis adapted Cam’s strategy to go at Ross, but he can’t out clown Killa himself.
March 23rd, 2009 at 3:23 pm
It looks like Fifty, Dre, and Em are doing a scene from the movie “Rain Man.” Dre is Tom Cruise and Em is Dustin Hoffman. Its why Fifty doesn’t have the same suit on.
March 23rd, 2009 at 3:23 pm
Eminem looks healthy and fine in that picture
^^
This is getting out of hand.
March 23rd, 2009 at 3:23 pm
“Never Scared” Remix >>>
“Front, back, side to side….”
March 23rd, 2009 at 3:23 pm
Curtis is 33 years old and still wearing colorful fitteds and tall tees…
with all the money he has he could of gone to Brooks & Brothers…
March 23rd, 2009 at 3:23 pm
*daps DPS*
*eats at Dunkin Donuts in North Philly*
March 23rd, 2009 at 3:23 pm
smha new post just 4 a pic of Crack a bottle..
March 23rd, 2009 at 3:23 pm
Prince Says:
March 23rd, 2009 at 3:21 pm
Nestle Snipes Says:
March 23rd, 2009 at 3:16 pm
Joe Budden vs. Cam’ron
would be good battle…who would the stans pull for…
^KIILA easy, joey B aint got nottin on CAM
^^^
battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.
March 23rd, 2009 at 3:24 pm
A tribe called quest Says:
March 23rd, 2009 at 3:21 pm
First off – he’s 6′2 & a half” and BIG.
=========================
Ayo!!
March 23rd, 2009 at 3:24 pm
MUNKEEEE
March 23rd, 2009 at 3:24 pm
A tribe called quest Says:
March 23rd, 2009 at 3:22 pm
^Gaining weight is your idea of spiraling downward? LOL.
He could be extra skinny and really spiraling if you know what I’m saying.
(I’m referencing Cocaine use)
–lol na, i mean they said he was taking pills, excessively eating, went to the hospital for something weight related.
^Yeah, he was on the Elvis workout plan…
March 23rd, 2009 at 3:24 pm
^KIILA easy, joey B aint got nottin on CAM
^^
False.Joey would murda Cam easy bar for bar.you cant be serious
March 23rd, 2009 at 3:24 pm
where is rent $500 a month?
^^
Detroit. And a select few slum areas in Calcutta.
March 23rd, 2009 at 3:25 pm
he’s a mungggggkeyyyyyy..he’s a homo..he’s a munggggkeyyyyyy…Tia aint tell him shit..he’s a mungggkeyyyy.
LF: Anyone seen WSHH with the video with the diamond testers testing out his jewelry to prove its real?
No bang bang..no bang bang
“why yall be wearing that fake jewelry around me knowing I got a weak stomache?” …no bang bang
*sees Cammy B pull up in the hummer*
*jerks her off from outside*
March 23rd, 2009 at 3:25 pm
I style with them hammers…
March 23rd, 2009 at 3:25 pm
Vrooooooooooom Vroooooooooooom partystarter
March 23rd, 2009 at 3:25 pm
I wil with your nana
yea, doggy style on a hamper
March 23rd, 2009 at 3:25 pm
eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag
first u say the industry needs to destroy and rebuild and that record sales are meaningless
now ur saying that record sales do mean something, but that the bar has been lowered
ok so by this reasoning, by 2012, will 5-10k be the new “gold”?
shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE
can’t have ur cake and eat it too b.
*pre-empts eskay’s stock response, which is either cam pointing and saying “u mad” or cam on o’reilly saying “u mad”*
March 23rd, 2009 at 3:25 pm
where is rent $500 a month?
__________
Under the I 95
March 23rd, 2009 at 3:25 pm
Nestle Snipes Says:
March 23rd, 2009 at 3:23 pm
Curtis is 33 years old and still wearing colorful fitteds and tall tees…
with all the money he has he could of gone to Brooks & Brothers…
-============================================
Hov was 36 wearing a browns jersey in the Girls Girls Girls video
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
Still like his music for the most part. No shots!
March 23rd, 2009 at 3:26 pm
Curtis is 33 years old and still wearing colorful fitteds and tall tees…
with all the money he has he could of gone to Brooks & Brothers…
^Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.
March 23rd, 2009 at 3:26 pm
I wil with your nana
yea, doggy style on a hamper
^^
What up homie?
March 23rd, 2009 at 3:26 pm
# COCCA88CRAZY88SINCE88 Says:
March 23rd, 2009 at 3:23 pm
Prince Says:
March 23rd, 2009 at 3:21 pm
Nestle Snipes Says:
March 23rd, 2009 at 3:16 pm
Joe Budden vs. Cam’ron
would be good battle…who would the stans pull for…
^KIILA easy, joey B aint got nottin on CAM
^^^
battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.
^ motherfuckers have gotten too lazy and polite.. kinda like nah.
March 23rd, 2009 at 3:26 pm
that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even.
March 23rd, 2009 at 3:26 pm
Pop pop pop
I lit the dark
Play the wizard dog
Go get some heart
That’s courage and brains
Caine
on several strips
Not from Houston
But shit,
Call me Lil Flip
March 23rd, 2009 at 3:27 pm
*daps dlock*
Aint shit fam
March 23rd, 2009 at 3:27 pm
>>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.
sho ya right. Hov rocked a suit on the cover of RD.
March 23rd, 2009 at 3:27 pm
# MiamiDaze Says:
March 23rd, 2009 at 3:25 pm
where is rent $500 a month?
__________
Under the I 95
^ lol
March 23rd, 2009 at 3:27 pm
Young Tyrone Lazarus Jenkins the Fif aka YTLJ5 aka White Boy Swag, Black Boy Tags Says:
March 23rd, 2009 at 3:25 pm
eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag
first u say the industry needs to destroy and rebuild and that record sales are meaningless
now ur saying that record sales do mean something, but that the bar has been lowered
ok so by this reasoning, by 2012, will 5-10k be the new “gold”?
shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE
can’t have ur cake and eat it too b.
=-====================================
Didn’t wanna say nuthin’, but yeah, what he said.
March 23rd, 2009 at 3:28 pm
eskay Says:
March 23rd, 2009 at 3:27 pm
>>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.
sho ya right. Hov rocked a suit on the cover of RD.
^^^
can we applaud Slick Rick?
March 23rd, 2009 at 3:28 pm
green eyes Says:
^KIILA easy, joey B aint got nottin on CAM
^^^
battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.
^ motherfuckers have gotten too lazy and polite.. kinda like nah.
^^^
Soft like a twinkie fillin…
March 23rd, 2009 at 3:28 pm
>>now ur saying that record sales do mean something, but that the bar has been lowered
please show me where I said record sales mean something you ignorant sack of monkey dung. I’ll wait.
March 23rd, 2009 at 3:28 pm
who’s veronica?
March 23rd, 2009 at 3:28 pm
*pre-empts eskay’s stock response, which is either cam pointing and saying “u mad” or cam on o’reilly saying “u mad”*
–*Dead* And..
nahright.com/news/wp-content/uploads/2009/02/cam-true-mag.jpg
March 23rd, 2009 at 3:29 pm
eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag
first u say the industry needs to destroy and rebuild and that record sales are meaningless
now ur saying that record sales do mean something, but that the bar has been lowered
ok so by this reasoning, by 2012, will 5-10k be the new “gold”?
shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE
can’t have ur cake and eat it too b.
^^^THIS
March 23rd, 2009 at 3:29 pm
COCCA88CRAZY88SINCE88 Says:
March 23rd, 2009 at 3:28 pm
eskay Says:
March 23rd, 2009 at 3:27 pm
>>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.
sho ya right. Hov rocked a suit on the cover of RD.
^^^
can we applaud Slick Rick?
======================
Werd.
What about Big Daddy kane?
Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.
March 23rd, 2009 at 3:29 pm
seriously, I hope you kept the receipt for your law degree chea, because you’s a non-reading ass nigga.
March 23rd, 2009 at 3:29 pm
green eyes Says:
March 23rd, 2009 at 3:28 pm
who’s veronica?
^^^
what her titties look like?
March 23rd, 2009 at 3:29 pm
Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo.
March 23rd, 2009 at 3:29 pm
# COCCA88CRAZY88SINCE88 Says:
March 23rd, 2009 at 3:28 pm
green eyes Says:
^KIILA easy, joey B aint got nottin on CAM
^^^
battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.
^ motherfuckers have gotten too lazy and polite.. kinda like nah.
^^^
Soft like a twinkie fillin…
^ all weak and pussified…
March 23rd, 2009 at 3:30 pm
eskay Says:
March 23rd, 2009 at 3:26 pm
that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even
^^
What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund
March 23rd, 2009 at 3:30 pm
By saying “20-50k is the new gold”, you’re kinda implying that those stats still mean something.
March 23rd, 2009 at 3:30 pm
sho ya right. Hov rocked a suit on the cover of RD.
^That was for one pic, but whatever…the 50 suit was for one night so point taken.
Regardless, Hov was not rocking suits for the interim btwn RD & Black Album.
March 23rd, 2009 at 3:31 pm
can’t wait for the video !
March 23rd, 2009 at 3:31 pm
Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo
^^
The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.
March 23rd, 2009 at 3:31 pm
# green eyes Says:
^ where is rent $500 a month?
^^
TX
Granted not the biggest apt, but a if you live alone its decent.
My homeboy Pays $400 & his shit is like 600 sq. ft.
March 23rd, 2009 at 3:31 pm
Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.
====================—————–
Hov designed the NY fitted/NY Yankee pinstripes
March 23rd, 2009 at 3:31 pm
record sales will always mean something.
whether it be digital or a physical sale.
fact.
March 23rd, 2009 at 3:31 pm
battles are corny right now.
====================
I disagree.
The Sai/Budden shit was highly entertaining.
March 23rd, 2009 at 3:31 pm
What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund
________________
He had a chopper, no training can save you from them bullets
March 23rd, 2009 at 3:32 pm
What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund
^Not that hard….swat bussed into his apartment…he had an AK and let off a hail of gunfire. Two was actually on the lower end of what he could’ve done.
March 23rd, 2009 at 3:32 pm
that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even.
–Smh i was just reading this
mercurynews.com/breakingnews/ci_11977785
I wonder if they set up something to donate to the families of oscar grant.
March 23rd, 2009 at 3:32 pm
By saying “20-50k is the new gold”, you’re kinda implying that those stats still mean something.
^^
I actually took from it that he was implying the opposite. That record sales dont really matter at all in the “new” industry.
March 23rd, 2009 at 3:32 pm
the statement “20K is the new Gold” in no way implies that record sales mean anything. I’m just saying that the bar has been lowered and you niggas who care about such things shouldn’t look at 20-50k sales as flops like you did 5 years ago.
Do i think record sales are meaningless? yes, in certain respects, but to say that i feel that way in general is to oversimplify my statement. of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.
March 23rd, 2009 at 3:32 pm
The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.
^Wafflecoasters
March 23rd, 2009 at 3:32 pm
Crack a bottle? Btw wasn’t that shut due out like a week ago?
March 23rd, 2009 at 3:33 pm
Regardless, Hov was not rocking suits for the interim btwn RD & Black Album.
==============================
Check the cover of Vol. 2.
March 23rd, 2009 at 3:33 pm
^ motherfuckers have gotten too lazy and polite.. kinda like nah.
^^^
‘Member? Catz and chicks would wrasslin’, tumblin’ through here like old west movies? Ether fired off in every direction, babies gettin’ caught in the crossfire, ninjas pissin’ in the pool, havin the sauna smellin’ like hot dog water?
Them was the dayz…
March 23rd, 2009 at 3:33 pm
M.Tyson Says:
March 23rd, 2009 at 3:31 pm
Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.
====================—————–
Hov designed the NY fitted/NY Yankee pinstripes
=================================
Yeah. Right. Whatever.
March 23rd, 2009 at 3:34 pm
Hov > Big
March 23rd, 2009 at 3:34 pm
Hov > Big
^^
foh
March 23rd, 2009 at 3:34 pm
wait….who the fuck wears suits without ties?
em and dre i fuckin love you guys (none) but this is a loss.
March 23rd, 2009 at 3:35 pm
Check the cover of Vol. 2.
^LOL, I give up.
March 23rd, 2009 at 3:35 pm
# b-ease Says:
March 23rd, 2009 at 3:31 pm
Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo
^^
The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.
^^
GGGGGAAAAAAAAATTTTTTTT
March 23rd, 2009 at 3:35 pm
D_Block_4_Life Says:
March 23rd, 2009 at 3:34 pm
Hov > Big
============================================
by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk
March 23rd, 2009 at 3:35 pm
of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.
^
so…. at the end of the day record sales do matter.
March 23rd, 2009 at 3:36 pm
>>Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.
who’s saying that? not me, I didn’t even bring up Hov, this nigga did.
that said, Hov = GOAT
March 23rd, 2009 at 3:36 pm
# Beezy Says:
March 23rd, 2009 at 3:32 pm
What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund
^Not that hard….swat bussed into his apartment…he had an AK and let off a hail of gunfire. Two was actually on the lower end of what he could’ve done.
^ nah, still sounds fishy to me.. generaly speaking swats a little more careful than that.. esp if you talking just up against 1 guy
March 23rd, 2009 at 3:37 pm
Hov > Big
–Dont start b
March 23rd, 2009 at 3:37 pm
eminem videos>>>>>>>>>>>>>>>_____ videos
March 23rd, 2009 at 3:37 pm
nah, still sounds fishy to me.. generaly speaking swats a little more careful than that.. esp if you talking just up against 1 guy
>Well he just had a little handgun that he murked the first two cops with. They were expecting a six shooter but ran into a howitzer.
March 23rd, 2009 at 3:37 pm
D_Block_4_Life Says:
March 23rd, 2009 at 3:34 pm
Hov > Big
^
not this again, but if you wanna go there
Pun > Big L > Big > Jay-Z
March 23rd, 2009 at 3:37 pm
eskay, your implication was that record sales mean “something” (and you’ve basically admitted as much in a subsequent comment) — otherwise why would u even set a bar for “the new gold” — why wouldn’t you just say gold is now irrelevant. but you didn’t say it was irrelevant – you just adjusted the metric. and now you’re saying it’s somewhat relevant for an artist putting food on the table. jury? what do you think?
btw it appears that you’re only mad because people are co-signing me emphatically while you just keep making ad hominem attacks about my law degree. lol – as if i care.
i wouldn’t have to put you in line if you had some humility but your comments are always phrased as if God has spoken so why reply with restraint when obviously your only goal is to have someone respond as i have. just giving you what you asked for [||]
March 23rd, 2009 at 3:37 pm
Big L > Jay-Z
March 23rd, 2009 at 3:37 pm
of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.
^
so…. at the end of the day record sales do matter.
^^
But less and less everyday. Artists have always gotten the majority of their money from shoes, so you dont need album sales to eat, just a fanbase and a decent tour scheldule.
Record label employess are a different story, but we’ve already established that they’re the true losers in all of this.
March 23rd, 2009 at 3:38 pm
Hov > Big
============================================
by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk
^^
coulda woulda shoulda. it is wat it is. you cant really talk about what mightve happened bc it DIDNT HAPPEN.
March 23rd, 2009 at 3:38 pm
their money from shoes,
^^
LOL
*edit – shows
March 23rd, 2009 at 3:38 pm
>>so…. at the end of the day record sales do matter.
not to me though. but again, it’s not that simple. I’m a music blogger, so when Soundscan’s come out, it behooves me to look at them and consider who sold what. but in a strictly personal sense, you niggas know I don’t fucking judge artists on their #’s like some of you fucking cowards on here. no shots.
March 23rd, 2009 at 3:39 pm
‘Member? Catz and chicks would wrasslin’, tumblin’ through here like old west movies? Ether fired off in every direction, babies gettin’ caught in the crossfire, ninjas pissin’ in the pool, havin the sauna smellin’ like hot dog water?
Them was the dayz…
^^^Yea..i still try and keep it real here, these niggas soft now tho, bunch of Asher rothwalecharleshammy..niggas be tellin me to log off and don’t come back, postin pics to animated gifs..real Algernod shit.
March 23rd, 2009 at 3:39 pm
Dude just wasn’t goin’ back. You’d be amazed at what you could do with a warrant out on you facin’ 3 strikes, an AK and a little motivation…
March 23rd, 2009 at 3:39 pm
Big L > Jay-Z
^^
Big Pun > Big L
March 23rd, 2009 at 3:39 pm
Beezy Says:
March 23rd, 2009 at 3:37 pm
Big L > Jay-Z
^
straight spittin, then yes, but i think only me and you like Big L up in here beezy. (n/h)
March 23rd, 2009 at 3:40 pm
just remember in my city 50k is going gold
-Rappin ass Degrasi nigga-
March 23rd, 2009 at 3:40 pm
is currency signed?
March 23rd, 2009 at 3:40 pm
What the fuck ya’ll talking, Hov invented metaphors
March 23rd, 2009 at 3:40 pm
Pun > Big L > Big > Jay-Z
–Lets do a rorschach test, tell me what you see in this picture
4.bp.blogspot.com/_XpzVbtlY8wE/STy3lSXgNQI/AAAAAAAAA7Y/FURM51sgwxc/s400/biggie-smalls.jpg
March 23rd, 2009 at 3:41 pm
but i think only me and you like Big L up in here beezy. (n/h)
^Lots of fans, just no one who think he’s the GOAT like me.
L blended everything perfectly…streets, lyrics, punchlines….
“How come, you can listen to my first al-bum
and tell where alot niggas got they whole style from…”
March 23rd, 2009 at 3:42 pm
Ok, for some reason my comments keep getting modded.
March 23rd, 2009 at 3:42 pm
# I Hate My Job Says:
March 23rd, 2009 at 3:40 pm
What the fuck ya’ll talking, Hov invented metaphors
^^^^
Hov single-handedly saved my second and fourth marriages AND taught me not to be ashamed of my body. (NH)
March 23rd, 2009 at 3:43 pm
btw it appears that you’re only mad because people are co-signing me emphatically while you just keep making ad hominem attacks about my law degree. lol – as if i care.
i wouldn’t have to put you in line if you had some humility but your comments are always phrased as if God has spoken so why reply with restraint when obviously your only goal is to have someone respond as i have. just giving you what you asked for [||]
^^That’s how you get your blog game poppin son..half these niggas you see come in here startin shit, gettin niggas riled up..is eskay and his wifey on two different comps in the same room.
Sean Coonery = Mrs Ashmi
March 23rd, 2009 at 3:43 pm
# M.Tyson Says:
============================================
by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk
^^
But he didn’t so this is irrelevant. lol
March 23rd, 2009 at 3:43 pm
not to me though. but again, it’s not that simple. I’m a music blogger, so when Soundscan’s come out, it behooves me to look at them and consider who sold what. but in a strictly personal sense, you niggas know I don’t fucking judge artists on their #’s like some of you fucking cowards on here. no shots.
^
i dont judge by that, but im saying, you cant sit there and tell an artist or a record exec sales dont matter. to you and other fans, maybe not, but at the end of the day your lack of ‘judgement’ upon these rappers means shit to them, cos they ass getting dropped of they dont sell.
thats my view on it anyway.
March 23rd, 2009 at 3:43 pm
>>eskay, your implication was that record sales mean “something” (and you’ve basically admitted as much in a subsequent comment) — otherwise why would u even set a bar for “the new gold” — why wouldn’t you just say gold is now irrelevant. but you didn’t say it was irrelevant – you just adjusted the metric. and now you’re saying it’s somewhat relevant for an artist putting food on the table. jury? what do you think?
step your litigation game up. no, I did not imply that and you know this because I’m telling you that’s not what I implied. when you say “mean something” what exactly do you mean? that they mean something to me as a fan of hip-hop, to me as a music blogger and industry observer or do you mean that they are no longer relevant in the grand scheme of an artists career? because all of these have different answers, and none of them are black and white. you’re the one who brought up the whole “do sales matter” shit, not me, so you define it. If you wanna have a serious conversation about whether or not sales “matter” than we can have it. but you just seem like you wanna argue.
March 23rd, 2009 at 3:43 pm
If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want
March 23rd, 2009 at 3:43 pm
Now I can’t even capitalize MINUTE. What else can’t I not emphasize? I LOVE EM! btw Can’t for that white boys album.
March 23rd, 2009 at 3:44 pm
Can’t wait*
March 23rd, 2009 at 3:45 pm
LF: I actually read a whole 400 plus comment post the other day..good ole days…
Shout out to LL not the rapper, Kween of all Kweens.
March 23rd, 2009 at 3:45 pm
Sean Coonery = Mrs Ashmi
^
*retires*
–
step your litigation game up.
^
but why? i’m a corporate lawyer.
–
If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want
^
*jumps out of a window*
March 23rd, 2009 at 3:46 pm
Now I can’t even capitalize MINUTE. What else can’t I not emphasize? I LOVE EM! btw Can’t for that white boys album.
^^
You can do whatever you want dude. I just feel obligated to point it out when it sounds gay.
March 23rd, 2009 at 3:46 pm
–Im glad terry is getting some shine as a lead actor. Dude is downright hilarious
Terry killed that Vanessa Carlton joint in White Chicks.
March 23rd, 2009 at 3:46 pm
big l is my fav rapper and a goat to me
the only problem is his lack of commercial success is something i cannot defend and what others use to take his goat crown away.
him and pun are the best i have ever heard spit, real talk.
March 23rd, 2009 at 3:46 pm
AmpGeez a.k.a. Mr. Solo Dolo Says:
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
^Smh. It was a punchline about jewelry for Pete’s sake.
Jeses fuckin’ Christ.
March 23rd, 2009 at 3:46 pm
If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want
^
*jumps out of a window*
^^
LOL
But in all seriousness, does anyone know how much Padded Room sold?
March 23rd, 2009 at 3:47 pm
Jay-Z > Big L > Big Pun > Big
Fixed
March 23rd, 2009 at 3:48 pm
furthermore chea, I don’t see not one person co-signing you emphatically and my word is the word of God nigga, you could never put me in line. FACT: i know far more and have thought far longer about how the music industry works than you have, so I could never ever lose this argument with you.
March 23rd, 2009 at 3:48 pm
I hated anyone getting into music to make money.
Integrity > Cooning
Yes i turned Coon into a verb, get over it
March 23rd, 2009 at 3:48 pm
*gets caught in illegitimate hustle*
*does not hire chea as lawyer*
March 23rd, 2009 at 3:48 pm
# b-ease Says:
March 23rd, 2009 at 3:46 pm
If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want
^
*jumps out of a window*
^^
LOL
But in all seriousness, does anyone know how much Padded Room sold?
^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
March 23rd, 2009 at 3:48 pm
I Hate My Job Says:
March 23rd, 2009 at 3:47 pm
Jay-Z > Big L > Big Pun > Big
Fixed
^
woah woah woah, straight spittin, no one comes above pun and l.
March 23rd, 2009 at 3:49 pm
Yes i turned Coon into a verb, get over it
^^
*blank stare*
March 23rd, 2009 at 3:49 pm
# A tribe called quest Says:
March 23rd, 2009 at 3:40 pm
Pun > Big L > Big > Jay-Z
–Lets do a rorschach test, tell me what you see in this picture
4.bp.blogspot.com/_XpzVbtlY8wE/STy3lSXgNQI/AAAAAAAAA7Y/FURM51sgwxc/s400/biggie-smalls.jpg
^ ^
Ok, Biggie after a trip to Burger King.
March 23rd, 2009 at 3:50 pm
40 MINUTES TO GO!!!!!!!!!!!!!!!!!!!!!!
March 23rd, 2009 at 3:50 pm
Hov single-handedly saved my second and fourth marriages AND taught me not to be ashamed of my body. (NH)
*Joins Oakland SWAT*
March 23rd, 2009 at 3:50 pm
FACT: i know far more and have thought far longer about how the music industry works than you have, so I could never ever lose this argument with you.
–*Throws flag*
[Eskay is old as fuck joke here]
March 23rd, 2009 at 3:51 pm
Padded Room did 12k, no?
I didnt support, but I would’ve if it was better.
March 23rd, 2009 at 3:52 pm
You guys got it all wrong… It goes like this:
2PAC > NAS > BIG > JAY-Z > BIG L > EMINEM.
March 23rd, 2009 at 3:52 pm
D. Billz Says:
March 23rd, 2009 at 3:46 pm
AmpGeez a.k.a. Mr. Solo Dolo Says:
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
^Smh. It was a punchline about jewelry for Pete’s sake.
Jeses fuckin’ Christ.
=======================================
Dude needs to keep other MC’s names outta his mouth. He does this
purposely to bait niggas. It’s some hoe shit, b.
March 23rd, 2009 at 3:52 pm
^^
*blank stare*
–*Donates keyboard to salvation army*
March 23rd, 2009 at 3:53 pm
# Johnny Cadelco Says:
March 23rd, 2009 at 3:52 pm
You guys got it all wrong… It goes like this:
2PAC > NAS > BIG > JAY-Z > BIG L > EMINEM.
^ oh god
March 23rd, 2009 at 3:53 pm
“suits” it’s ‘Rain Man’, dummies
March 23rd, 2009 at 3:53 pm
D. Billz Says:
March 23rd, 2009 at 3:46 pm
AmpGeez a.k.a. Mr. Solo Dolo Says:
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
^Smh. It was a punchline about jewelry for Pete’s sake.
Jeses fuckin’ Christ.
^^
You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.
March 23rd, 2009 at 3:54 pm
# green eyes Says:
March 23rd, 2009 at 3:48 pm
# b-ease Says:
March 23rd, 2009 at 3:46 pm
If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want
^
*jumps out of a window*
^^
LOL
But in all seriousness, does anyone know how much Padded Room sold?
^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
^Check, check, annnnnd… check.
March 23rd, 2009 at 3:54 pm
Saying Big > Jay is like saying Kobe> Jordan
6 rings > 3 rings
March 23rd, 2009 at 3:54 pm
^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
^^I thought I saw a video of TY buying out the whole store?
March 23rd, 2009 at 3:54 pm
Dude needs to keep other MC’s names outta his mouth. He does this
purposely to bait niggas. It’s some hoe shit, b.
^^^
So you basically just hate his whole existence right? I can respect that.
March 23rd, 2009 at 3:54 pm
Dude needs to keep other MC’s names outta his mouth. He does this
purposely to bait niggas. It’s some hoe shit, b.
–Yo fuck that, if you have a problem with someone why cant you say their name.
Smh @ Holding your tongue.
March 23rd, 2009 at 3:55 pm
# green eyes Says:
^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
^^
I bought a DL too, so that’s like 5 right?
lol
March 23rd, 2009 at 3:55 pm
BTW
*daps ALL in attendance*
March 23rd, 2009 at 3:55 pm
# Jersey*made*me Says:
March 23rd, 2009 at 3:53 pm
D. Billz Says:
March 23rd, 2009 at 3:46 pm
AmpGeez a.k.a. Mr. Solo Dolo Says:
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
^Smh. It was a punchline about jewelry for Pete’s sake.
Jeses fuckin’ Christ.
^^
You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.
^POW!
March 23rd, 2009 at 3:56 pm
lol @ POW for some reason…. reminds me of 1970s Batman.
March 23rd, 2009 at 3:56 pm
# Mic The Hand Tony Says:
March 23rd, 2009 at 3:54 pm
^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
^^I thought I saw a video of TY buying out the whole store?
^*dies*
March 23rd, 2009 at 3:57 pm
*expenses afternoon to chea’s lawfirm*
March 23rd, 2009 at 3:57 pm
Kobe = Jordan
March 23rd, 2009 at 3:58 pm
You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.
–I told you, Amp = Joeys baby moms brother
March 23rd, 2009 at 3:59 pm
# A tribe called quest Says:
March 23rd, 2009 at 3:58 pm
You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.
–I told you, Amp = Joeys baby moms
brotherMarch 23rd, 2009 at 3:59 pm
I deleted Padded Room to make room for Thank You….Joe Budden music was better before the recession…now that we all sad and emo..its no fun to be like everyone else..I switched my game up..I’m on some happy shit now…Ijerk
March 23rd, 2009 at 3:59 pm
AmpGeez a.k.a. Mr. Solo Dolo Says:
March 23rd, 2009 at 3:26 pm
Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.
Still like his music for the most part. No shots!
======================================
My statement in it’s entierty. Why don’t y’all get off the man’s dick, like he does no wrong.
Shits fucking disgusting, b.
March 23rd, 2009 at 3:59 pm
nas is definitely not in my top 5, im sorry but after illmatic it was just downhill.
pac would be last if it was lyrical skill and wordplay, out of the few goats i would mention but only because the others have come up with better rhymes.
however pac is one of the most influential and most passionate rappers ever and i like how he repped black people in his songs, they even talked about him in congress, and no other rapper at the time was that influential.
March 23rd, 2009 at 4:01 pm
i like how he repped black people in his songs
______________
I don’t know how to feel about that statement.
March 23rd, 2009 at 4:01 pm
green eyes Says:
March 23rd, 2009 at 3:59 pm
# A tribe called quest Says:
March 23rd, 2009 at 3:58 pm
You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.
–I told you, Amp = Joeys baby moms brother
==============================
Really? Fall back, big lips.
I dig some of his stuff, but he does bitch ass shit. Just like Hov. Y’all act like the nigga is GOD or something.
March 23rd, 2009 at 4:02 pm
nas is definitely not in my top 5, im sorry but after illmatic it was just downhill.
^^
It Was Written is one of the greatest hiphop albums of all time. Lost Tapes was insane. Most people would say Stillmatic is a classic (not sure if i would tho), and Streets Disciple is underrated.
So, no-sign.
March 23rd, 2009 at 4:03 pm
I’m copping a joe88 eventhough I never heard him ryhme. Who’s with me?
March 23rd, 2009 at 4:06 pm
chea’s either typing a dissertation in response to my ether, or he’s on the phone with his alma mater trying to re-book his first year curriculum.
March 23rd, 2009 at 4:07 pm
Thank God these guys are out there again. I just got into an argument with a 14-year old about how fuckin stupid lil wayne is. This little muthafucka tried to me i was old (i’m 19) and that my old age was the reason why i didnt like lil wayne. Lil Wayne honestly reminds me of how i used to like limpbizkit. This nigga is the George Bush of music.
ALL LIL WAYNE FANS ARE DUMBER THAN SARAH PALIN.
March 23rd, 2009 at 4:12 pm
maybe a eminem ft dr dre track
and just a fiddy guest in da video
March 23rd, 2009 at 4:13 pm
eskay Says:
March 23rd, 2009 at 3:36 pm
that said, Hov = GOAT
^^
stoppp. god. just stop it. he’s so overrated it’s disgusting.
March 23rd, 2009 at 5:05 pm
He probably didn’t wear the suit cause there were only two guys in suits in Rain Man
March 23rd, 2009 at 5:11 pm
I don’t think it is Crack A Bottle, that was supposed to be animated. This is probably for his first official singled, rumored to be called “We Made You.”
March 23rd, 2009 at 5:22 pm
Those suits look very similar to Kanye’s suit in the promo for 808′s.
March 23rd, 2009 at 5:46 pm
LOL 50 didnt fit in this picture at all, kinda sums up his career
March 23rd, 2009 at 6:22 pm
ladies and gentlemen, PEE WEE HERMAN.
March 23rd, 2009 at 9:03 pm
r u guyz fuckin retarded,
BIG>JAY
anyday
Ready 2 Die>Reasonable DOubt
Life After Death> Vol.1
March 23rd, 2009 at 9:12 pm
anyone know when this picture was shot??
I was in Vegas this passed weekend and could have went to see it!
saywhatsreal.com
March 23rd, 2009 at 10:37 pm
[...] a glass of Cpt. Morgan’s to Eskay] farkItButton(“Oh+Great%2C+Another+Eminem+Teaser”, [...]
March 24th, 2009 at 2:25 pm
so this video is based off the movie “rainman”? dre as tom cruise, em as dustin hoffman, and fif is who? just fif? 3rd wheel status