Pic: Eminem, Dr. Dre & Curtis on Video Set

em-curtis-dre

For what song? I don’t know, Interscope isn’t saying. But it’s supposedly Em’s first single. I can’t believe Boo-Boo couldn’t join the bosses and put on a suit. Show some courtesy Curtis.

In related news, it was announced a short while ago that Em will be inducting Run D.M.C. into the Rock & Roll Hall of Fame during the ceremony on April 4th.

UPDATE: RapRadar has the info. The song is called “We Made You”.


AddThis Social Bookmark Button

203 Responses to “Pic: Eminem, Dr. Dre & Curtis on Video Set”

  1. b-ease Says:

    Curtis is hilarious.

  2. green eyes Says:

    a never fucked woth em

  3. sb Says:

    em not blonde? cant wait for him to fully emerge. this guy is such a fucking mystery.

  4. Johnny Cadelco Says:

    I Love Em.

  5. COCCA88CRAZY88SINCE88 Says:

    L Seven ass niggas.

  6. Beezy Says:

    Curtis’ chip stack is smaller….subliminally being put in his place?

  7. D_Block_4_Life Says:

    a never fucked woth em
    ^^
    Shut up please.

  8. slime Says:

    why does eminem have a part in his head?

  9. A tribe called quest Says:

    Nahright stans for : Joe Budden, Cam’ron, Nikki Minaj’s box

    Fixed*

    No one gives 2 shits about her music

  10. b-ease Says:

    em not blonde? cant wait for him to fully emerge. this guy is such a fucking mystery.

    ^^
    Ay Fucking Yo

  11. b-ease Says:

    Johnny Cadelco Says:

    March 23rd, 2009 at 3:15 pm
    I Love Em.

    ^^
    Ay Fucking Yo.

    What the hell is going on here?

  12. Beezy Says:

    cant wait for him to fully emerge

    ^Holy Shit (c) ‘nard

  13. green eyes Says:

    # D_Block_4_Life Says:
    March 23rd, 2009 at 3:16 pm

    a never fucked woth em
    ^^
    Shut up please.

    ^ go swim in a shark tank

  14. A tribe called quest Says:

    a never fucked woth em
    ^^
    Shut up please.

    –Cosign

    *hugs greeny*

    No homo but its nice to see that em is skinny cause i heard dude was spiraling downwards after proof

  15. babydoll Says:

    COCCA88CRAZY88SINCE88 Says:

    March 23rd, 2009 at 3:16 pm
    L Seven ass niggas.

    ^LOL

  16. Da PartyStarter Says:

    Looks like some “Rain Man” shit… Wassup Nah..

  17. Most_Incredible! Says:

    youtube.com/watch?v=hQp5l4-sfFA > crack a bottle

  18. b-ease Says:

    *daps DPS*

  19. green eyes Says:

    # cOLD Says:
    March 23rd, 2009 at 3:16 pm

    3 cops got murked in cali? wow

    ^ thought it was 4, two were swat

  20. Beezy Says:

    No homo but its nice to see that em is skinny cause i heard dude was spiraling downwards after proof

    ^Gaining weight is your idea of spiraling downward? LOL.

    He could be extra skinny and really spiraling if you know what I’m saying.

    (I’m referencing Cocaine use)

  21. Big_seth Says:

    # D. Billz Says:
    March 23rd, 2009 at 3:03 pm

    If ninjas in the South are living a substantially financially secure life sellin’ shit outta their trunk, then it’s clear that a major was never needed. But the South actually support their artists. In that aspect, blame the fans. But the fact still remains that it can be done.
    ^^

    Why can’t NY just do the same.

    My only guess would be that due to the cost of living selling $10 CDs out your trunk still aint lucrative enough in NY. The cheaper cost of living helps keep this practice thriving.

    If I sell 100 CDs in a week, Thats a G & enough to pay rent for two months. Thats enough to pay one mortgage payment on a decent house in a decent area. LMAO. in NY, That won’t even cover eating street vendor food every day.

  22. AmpGeez a.k.a. Mr. Solo Dolo Says:

    ny music got stale
    ============
    Nah. The dumb nigga outnumber the smart niggas & dumb niggas love them some dumb, country ass music.
    —————————————————————
    where you getting your facts from? you honesly think if Cam called Just today for a beat, Just would say 200K? you live in a dream world.
    ==============================================
    Just ain’t fucking with Cam like that anyway.

    But I bet money he still gets $80-$100,000 a track.

  23. Mic The Hand Tony Says:

    For what song? I don’t know, Interscope isn’t saying. But it’s supposedly Em’s first single. I can’t believe Boo-Boo couldn’t join the bosses and put on a suit. Show some courtesy Curtis.

    ^^Real Mungkeyss don’t wear suits

  24. Nestle Snipes Says:

    Asher Roth, Wale, Charles Hamilton, Kid Cudi

    all these need to get on track together..and make music…

  25. green eyes Says:

    waht up party

  26. Beezy Says:

    ^ thought it was 4, two were swat

    >To me, if he didn’t die on the scene you should get credit for the body. Yeah you killed him, but this isnt amateur hour….dead him immediately!

    So 4 cops dead, 3 murdered.

  27. Da PartyStarter Says:

    Damn.. It like a Tuesday morning circa 2007 Greenie, C88S88, BD. LOL

    Wassup , Beezy (Phiily Standing up, but in front of a cop car and DEFINITELY not in West Philly, lol)

  28. b-ease Says:

    (I’m referencing Cocaine use)

    ^^
    Word, Em’s on a coke diet.

  29. babydoll Says:

    Da PartyStarter Says:

    March 23rd, 2009 at 3:18 pm
    Looks like some “Rain Man” shit… Wassup Nah..

    ^yeah, it does kinda look like that…lol *daps DPS*

  30. Beezy Says:

    To me, if he didn’t die on the scene you should get credit for the body.

    ^edit: shouldn’t

  31. COCCA88CRAZY88SINCE88 Says:

    Da PartyStarter Says:

    March 23rd, 2009 at 3:18 pm
    Looks like some “Rain Man” shit… Wassup Nah..

    ^^^
    *daps Disco Stu*

  32. green eyes Says:

    # Big_seth Says:
    March 23rd, 2009 at 3:19 pm

    # D. Billz Says:
    March 23rd, 2009 at 3:03 pm

    If ninjas in the South are living a substantially financially secure life sellin’ shit outta their trunk, then it’s clear that a major was never needed. But the South actually support their artists. In that aspect, blame the fans. But the fact still remains that it can be done.
    ^^

    Why can’t NY just do the same.

    My only guess would be that due to the cost of living selling $10 CDs out your trunk still aint lucrative enough in NY. The cheaper cost of living helps keep this practice thriving.

    If I sell 100 CDs in a week, Thats a G & enough to pay rent for two months. Thats enough to pay one mortgage payment on a decent house in a decent area. LMAO. in NY, That won’t even cover eating street vendor food every day.

    ^ where is rent $500 a month?

  33. Da PartyStarter Says:

    Hey Greenie!!!!

  34. A tribe called quest Says:

    First off – he’s 6’2 & a half” and BIG. He’s a former San Diego Charger. He made his screen debut with Arnold Schwarzeneggar in THE 6TH DAY. And his most recent film will be this summer’s Arnie-less TERMINATOR SALVATION. He is TERRY CREWS. Not necessarily a big name, but a big man to take his place among other big men. As I said, Sly seems very enthusiastic about this fella and I look forward to seeing what Terry Crews has in store for us.

    –Im glad terry is getting some shine as a lead actor. Dude is downright hilarious

  35. Prince Says:

    Nestle Snipes Says:

    March 23rd, 2009 at 3:16 pm
    Joe Budden vs. Cam’ron

    would be good battle…who would the stans pull for…

    ^KIILA easy, joey B aint got nottin on CAM

  36. I Hate My Job Says:

    Nahright stans for : Joe Budden, Cam’ron, Nikki Minaj’s box,GUCCI

    Fixed

  37. Nestle Snipes Says:

    Joe Budden vs. Cam’ron

    would be good battle…who would the stans pull for…

  38. Beezy Says:

    Word, Em’s on a coke diet.

    ^I hope he isn’t on the Charles Hamilton diet (coke & semen)

  39. cOLD Says:

    take a good look at Dr Dre, nigga face look like he got the LL treatment. Compared to that last pic of Dre that was posted, he looks a lot younger.

  40. babydoll Says:

    Da PartyStarter Says:

    March 23rd, 2009 at 3:20 pm
    Damn.. It like a Tuesday morning circa 2007

    ^LOL…right?

  41. D_Block_4_Life Says:

    Crack a bottle..

  42. Nestle Snipes Says:

    Eminem looks healthy and fine in that picture…Glad to see that he is no longer battling that pill addiction/depression.

  43. Prince Says:

    y em looklike pee wee herman

  44. b-ease Says:

    Yeah you killed him, but this isnt amateur hour….dead him immediately!

    ^^
    That sounds like an Uncle Murda adlib, lol.

  45. D_Block_4_Life Says:

    Everybody woddle…

  46. Da PartyStarter Says:

    C88S88,BD, SC,B-Ease and the rest “Wassup?”
    *Daps and church hugs…Daps and Church hugs…*

  47. A tribe called quest Says:

    ^Gaining weight is your idea of spiraling downward? LOL.

    He could be extra skinny and really spiraling if you know what I’m saying.

    (I’m referencing Cocaine use)

    –lol na, i mean they said he was taking pills, excessively eating, went to the hospital for something weight related.

  48. AmpGeez a.k.a. Mr. Solo Dolo Says:

    Killa Vs. Curtis is unfinished buisness IMO.

    Crtis adapted Cam’s strategy to go at Ross, but he can’t out clown Killa himself.

  49. Jefe Says:

    It looks like Fifty, Dre, and Em are doing a scene from the movie “Rain Man.” Dre is Tom Cruise and Em is Dustin Hoffman. Its why Fifty doesn’t have the same suit on.

  50. b-ease Says:

    Eminem looks healthy and fine in that picture

    ^^
    This is getting out of hand.

  51. D_Block_4_Life Says:

    “Never Scared” Remix >>>

    “Front, back, side to side….”

  52. Nestle Snipes Says:

    Curtis is 33 years old and still wearing colorful fitteds and tall tees…

    with all the money he has he could of gone to Brooks & Brothers…

  53. Beezy Says:

    *daps DPS*

    *eats at Dunkin Donuts in North Philly*

  54. AJ Says:

    smha new post just 4 a pic of Crack a bottle..

  55. COCCA88CRAZY88SINCE88 Says:

    Prince Says:

    March 23rd, 2009 at 3:21 pm
    Nestle Snipes Says:

    March 23rd, 2009 at 3:16 pm
    Joe Budden vs. Cam’ron

    would be good battle…who would the stans pull for…

    ^KIILA easy, joey B aint got nottin on CAM

    ^^^
    battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.

  56. AmpGeez a.k.a. Mr. Solo Dolo Says:

    A tribe called quest Says:

    March 23rd, 2009 at 3:21 pm
    First off – he’s 6′2 & a half” and BIG.
    =========================
    Ayo!!

  57. M.Tyson Says:

    MUNKEEEE

  58. babydoll Says:

    A tribe called quest Says:

    March 23rd, 2009 at 3:22 pm
    ^Gaining weight is your idea of spiraling downward? LOL.

    He could be extra skinny and really spiraling if you know what I’m saying.

    (I’m referencing Cocaine use)

    –lol na, i mean they said he was taking pills, excessively eating, went to the hospital for something weight related.

    ^Yeah, he was on the Elvis workout plan…

  59. I Hate My Job Says:

    ^KIILA easy, joey B aint got nottin on CAM
    ^^
    False.Joey would murda Cam easy bar for bar.you cant be serious

  60. b-ease Says:

    where is rent $500 a month?

    ^^
    Detroit. And a select few slum areas in Calcutta.

  61. Mic The Hand Tony Says:

    he’s a mungggggkeyyyyyy..he’s a homo..he’s a munggggkeyyyyyy…Tia aint tell him shit..he’s a mungggkeyyyy.

    LF: Anyone seen WSHH with the video with the diamond testers testing out his jewelry to prove its real?

    No bang bang..no bang bang

    “why yall be wearing that fake jewelry around me knowing I got a weak stomache?” …no bang bang

    *sees Cammy B pull up in the hummer*

    *jerks her off from outside*

  62. D_Block_4_Life Says:

    I style with them hammers…

  63. Mic The Hand Tony Says:

    Vrooooooooooom Vroooooooooooom partystarter

  64. b-ease Says:

    I wil with your nana
    yea, doggy style on a hamper

  65. Young Tyrone Lazarus Jenkins the Fif aka YTLJ5 aka White Boy Swag, Black Boy Tags Says:

    eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag

    first u say the industry needs to destroy and rebuild and that record sales are meaningless

    now ur saying that record sales do mean something, but that the bar has been lowered

    ok so by this reasoning, by 2012, will 5-10k be the new “gold”?

    shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE

    can’t have ur cake and eat it too b.

    *pre-empts eskay’s stock response, which is either cam pointing and saying “u mad” or cam on o’reilly saying “u mad”*

  66. MiamiDaze Says:

    where is rent $500 a month?

    __________

    Under the I 95

  67. M.Tyson Says:

    Nestle Snipes Says:

    March 23rd, 2009 at 3:23 pm
    Curtis is 33 years old and still wearing colorful fitteds and tall tees…

    with all the money he has he could of gone to Brooks & Brothers…
    -============================================
    Hov was 36 wearing a browns jersey in the Girls Girls Girls video

  68. AmpGeez a.k.a. Mr. Solo Dolo Says:

    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    Still like his music for the most part. No shots!

  69. Beezy Says:

    Curtis is 33 years old and still wearing colorful fitteds and tall tees…

    with all the money he has he could of gone to Brooks & Brothers…

    ^Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.

  70. D_Block_4_Life Says:

    I wil with your nana
    yea, doggy style on a hamper
    ^^
    What up homie?

  71. green eyes Says:

    # COCCA88CRAZY88SINCE88 Says:
    March 23rd, 2009 at 3:23 pm

    Prince Says:

    March 23rd, 2009 at 3:21 pm
    Nestle Snipes Says:

    March 23rd, 2009 at 3:16 pm
    Joe Budden vs. Cam’ron

    would be good battle…who would the stans pull for…

    ^KIILA easy, joey B aint got nottin on CAM

    ^^^
    battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.

    ^ motherfuckers have gotten too lazy and polite.. kinda like nah.

  72. eskay Says:

    that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even.

  73. b-ease Says:

    Pop pop pop
    I lit the dark
    Play the wizard dog
    Go get some heart
    That’s courage and brains
    Caine
    on several strips
    Not from Houston
    But shit,
    Call me Lil Flip

  74. b-ease Says:

    *daps dlock*

    Aint shit fam

  75. eskay Says:

    >>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.

    sho ya right. Hov rocked a suit on the cover of RD.

  76. green eyes Says:

    # MiamiDaze Says:
    March 23rd, 2009 at 3:25 pm

    where is rent $500 a month?

    __________

    Under the I 95

    ^ lol

  77. AmpGeez a.k.a. Mr. Solo Dolo Says:

    Young Tyrone Lazarus Jenkins the Fif aka YTLJ5 aka White Boy Swag, Black Boy Tags Says:

    March 23rd, 2009 at 3:25 pm
    eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag

    first u say the industry needs to destroy and rebuild and that record sales are meaningless

    now ur saying that record sales do mean something, but that the bar has been lowered

    ok so by this reasoning, by 2012, will 5-10k be the new “gold”?

    shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE

    can’t have ur cake and eat it too b.
    =-====================================
    Didn’t wanna say nuthin’, but yeah, what he said.

  78. COCCA88CRAZY88SINCE88 Says:

    eskay Says:

    March 23rd, 2009 at 3:27 pm
    >>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.

    sho ya right. Hov rocked a suit on the cover of RD.

    ^^^
    can we applaud Slick Rick?

  79. COCCA88CRAZY88SINCE88 Says:

    green eyes Says:

    ^KIILA easy, joey B aint got nottin on CAM

    ^^^
    battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.

    ^ motherfuckers have gotten too lazy and polite.. kinda like nah.

    ^^^
    Soft like a twinkie fillin…

  80. eskay Says:

    >>now ur saying that record sales do mean something, but that the bar has been lowered

    please show me where I said record sales mean something you ignorant sack of monkey dung. I’ll wait.

  81. green eyes Says:

    who’s veronica?

  82. A tribe called quest Says:

    *pre-empts eskay’s stock response, which is either cam pointing and saying “u mad” or cam on o’reilly saying “u mad”*

    –*Dead* And..

    nahright.com/news/wp-content/uploads/2009/02/cam-true-mag.jpg

  83. Mic The Hand Tony Says:

    eskay, the more i’ve been thinking about ur statement that “20-50k is the new gold”, the more i realize that u are an absurd and inconsistent douchebag

    first u say the industry needs to destroy and rebuild and that record sales are meaningless

    now ur saying that record sales do mean something, but that the bar has been lowered

    ok so by this reasoning, by 2012, will 5-10k be the new “gold”?

    shit’s disgusting b. be consistent. either record sales are meaningless or record sales mean something, in which case 20,000 is a FUCKING FAILURE

    can’t have ur cake and eat it too b.

    ^^^THIS

  84. AmpGeez a.k.a. Mr. Solo Dolo Says:

    COCCA88CRAZY88SINCE88 Says:

    March 23rd, 2009 at 3:28 pm
    eskay Says:

    March 23rd, 2009 at 3:27 pm
    >>Curtis was one of the first niggas rocking suits in hip-hop though…I remember the VMA he showed up with Veronica in a sharp suit…that was before Hov and everyone else got on it.

    sho ya right. Hov rocked a suit on the cover of RD.

    ^^^
    can we applaud Slick Rick?
    ======================
    Werd.

    What about Big Daddy kane?

    Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.

  85. eskay Says:

    seriously, I hope you kept the receipt for your law degree chea, because you’s a non-reading ass nigga.

  86. COCCA88CRAZY88SINCE88 Says:

    green eyes Says:

    March 23rd, 2009 at 3:28 pm
    who’s veronica?

    ^^^
    what her titties look like?

  87. Johnny Cadelco Says:

    Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo.

  88. green eyes Says:

    # COCCA88CRAZY88SINCE88 Says:
    March 23rd, 2009 at 3:28 pm

    green eyes Says:

    ^KIILA easy, joey B aint got nottin on CAM

    ^^^
    battles are corny right now. all the reall gully cats dont really spit hot shit, and the pussyAssNiggas make radio hits.

    ^ motherfuckers have gotten too lazy and polite.. kinda like nah.

    ^^^
    Soft like a twinkie fillin…

    ^ all weak and pussified…

  89. I Hate My Job Says:

    eskay Says:
    March 23rd, 2009 at 3:26 pm

    that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even
    ^^
    What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund

  90. AmpGeez a.k.a. Mr. Solo Dolo Says:

    By saying “20-50k is the new gold”, you’re kinda implying that those stats still mean something.

  91. Beezy Says:

    sho ya right. Hov rocked a suit on the cover of RD.

    ^That was for one pic, but whatever…the 50 suit was for one night so point taken.

    Regardless, Hov was not rocking suits for the interim btwn RD & Black Album.

  92. L-L Says:

    can’t wait for the video !

  93. b-ease Says:

    Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo

    ^^
    The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.

  94. Big_seth Says:

    # green eyes Says:

    ^ where is rent $500 a month?
    ^^
    TX

    Granted not the biggest apt, but a if you live alone its decent.

    My homeboy Pays $400 & his shit is like 600 sq. ft.

  95. M.Tyson Says:

    Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.

    ====================—————–
    Hov designed the NY fitted/NY Yankee pinstripes

  96. Danielson Says:

    record sales will always mean something.

    whether it be digital or a physical sale.

    fact.

  97. AmpGeez a.k.a. Mr. Solo Dolo Says:

    battles are corny right now.
    ====================
    I disagree.

    The Sai/Budden shit was highly entertaining.

  98. MiamiDaze Says:

    What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund
    ________________

    He had a chopper, no training can save you from them bullets

  99. Beezy Says:

    What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund

    ^Not that hard….swat bussed into his apartment…he had an AK and let off a hail of gunfire. Two was actually on the lower end of what he could’ve done.

  100. A tribe called quest Says:

    that nigga in Oakland went out like a fuckin G. that was for Oscar Grant yo, now we even.

    –Smh i was just reading this

    mercurynews.com/breakingnews/ci_11977785

    I wonder if they set up something to donate to the families of oscar grant.

  101. b-ease Says:

    By saying “20-50k is the new gold”, you’re kinda implying that those stats still mean something.

    ^^
    I actually took from it that he was implying the opposite. That record sales dont really matter at all in the “new” industry.

  102. eskay Says:

    the statement “20K is the new Gold” in no way implies that record sales mean anything. I’m just saying that the bar has been lowered and you niggas who care about such things shouldn’t look at 20-50k sales as flops like you did 5 years ago.

    Do i think record sales are meaningless? yes, in certain respects, but to say that i feel that way in general is to oversimplify my statement. of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.

  103. Beezy Says:

    The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.

    ^Wafflecoasters

  104. TJ Says:

    Crack a bottle? Btw wasn’t that shut due out like a week ago?

  105. AmpGeez a.k.a. Mr. Solo Dolo Says:

    Regardless, Hov was not rocking suits for the interim btwn RD & Black Album.
    ==============================
    Check the cover of Vol. 2.

  106. Da PartyStarter Says:

    ^ motherfuckers have gotten too lazy and polite.. kinda like nah.

    ^^^
    ‘Member? Catz and chicks would wrasslin’, tumblin’ through here like old west movies? Ether fired off in every direction, babies gettin’ caught in the crossfire, ninjas pissin’ in the pool, havin the sauna smellin’ like hot dog water?
    Them was the dayz…

  107. AmpGeez a.k.a. Mr. Solo Dolo Says:

    M.Tyson Says:

    March 23rd, 2009 at 3:31 pm
    Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.

    ====================—————–
    Hov designed the NY fitted/NY Yankee pinstripes
    =================================
    Yeah. Right. Whatever.

  108. D_Block_4_Life Says:

    Hov > Big

  109. b-ease Says:

    Hov > Big

    ^^
    foh

  110. ridalen Says:

    wait….who the fuck wears suits without ties?

    em and dre i fuckin love you guys (none) but this is a loss.

  111. Beezy Says:

    Check the cover of Vol. 2.

    ^LOL, I give up.

  112. Big_seth Says:

    # b-ease Says:
    March 23rd, 2009 at 3:31 pm

    Wait A MINUTE. I can’t say “I Love Em”. I’m a F-ing fan/stan of his. On that note I love Pac/Nas/Big & Jay. Jeez can’t say nada in here without someone saying you’re Ayooo

    ^^
    The way you capitilized “minute”, it reads like your neck is twisting, with a finger prepared to snap. Just proves my point.

    ^^

    GGGGGAAAAAAAAATTTTTTTT

  113. M.Tyson Says:

    D_Block_4_Life Says:

    March 23rd, 2009 at 3:34 pm
    Hov > Big

    ============================================
    by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk

  114. Danielson Says:

    of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.

    ^

    so…. at the end of the day record sales do matter.

  115. eskay Says:

    >>Niggas act like Hov invented the fucking wheel. Soon, you’ll be telling me he was the first to rock an NY fitted.

    who’s saying that? not me, I didn’t even bring up Hov, this nigga did.

    that said, Hov = GOAT

  116. green eyes Says:

    # Beezy Says:
    March 23rd, 2009 at 3:32 pm

    What I dont understand is how he was able to body two SWAT dudes..either he was extra gully or Oakland SWAT training programme needs a refund

    ^Not that hard….swat bussed into his apartment…he had an AK and let off a hail of gunfire. Two was actually on the lower end of what he could’ve done.

    ^ nah, still sounds fishy to me.. generaly speaking swats a little more careful than that.. esp if you talking just up against 1 guy

  117. A tribe called quest Says:

    Hov > Big

    –Dont start b

  118. buh Says:

    eminem videos>>>>>>>>>>>>>>>_____ videos

  119. Beezy Says:

    nah, still sounds fishy to me.. generaly speaking swats a little more careful than that.. esp if you talking just up against 1 guy

    >Well he just had a little handgun that he murked the first two cops with. They were expecting a six shooter but ran into a howitzer.

  120. Danielson Says:

    D_Block_4_Life Says:

    March 23rd, 2009 at 3:34 pm
    Hov > Big

    ^
    not this again, but if you wanna go there

    Pun > Big L > Big > Jay-Z

  121. Young Tyrone Lazarus Jenkins the Fif aka YTLJ5 aka White Boy Swag, Black Boy Tags Says:

    eskay, your implication was that record sales mean “something” (and you’ve basically admitted as much in a subsequent comment) — otherwise why would u even set a bar for “the new gold” — why wouldn’t you just say gold is now irrelevant. but you didn’t say it was irrelevant – you just adjusted the metric. and now you’re saying it’s somewhat relevant for an artist putting food on the table. jury? what do you think?

    btw it appears that you’re only mad because people are co-signing me emphatically while you just keep making ad hominem attacks about my law degree. lol – as if i care.

    i wouldn’t have to put you in line if you had some humility but your comments are always phrased as if God has spoken so why reply with restraint when obviously your only goal is to have someone respond as i have. just giving you what you asked for [||]

  122. Beezy Says:

    Big L > Jay-Z

  123. b-ease Says:

    of course record sales matter to the artist and the people who work at the label because that’s what puts food on their tables.

    ^

    so…. at the end of the day record sales do matter.

    ^^
    But less and less everyday. Artists have always gotten the majority of their money from shoes, so you dont need album sales to eat, just a fanbase and a decent tour scheldule.

    Record label employess are a different story, but we’ve already established that they’re the true losers in all of this.

  124. ridalen Says:

    Hov > Big

    ============================================
    by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk

    ^^
    coulda woulda shoulda. it is wat it is. you cant really talk about what mightve happened bc it DIDNT HAPPEN.

  125. b-ease Says:

    their money from shoes,

    ^^
    LOL

    *edit – shows

  126. eskay Says:

    >>so…. at the end of the day record sales do matter.

    not to me though. but again, it’s not that simple. I’m a music blogger, so when Soundscan’s come out, it behooves me to look at them and consider who sold what. but in a strictly personal sense, you niggas know I don’t fucking judge artists on their #’s like some of you fucking cowards on here. no shots.

  127. Mic The Hand Tony Says:

    ‘Member? Catz and chicks would wrasslin’, tumblin’ through here like old west movies? Ether fired off in every direction, babies gettin’ caught in the crossfire, ninjas pissin’ in the pool, havin the sauna smellin’ like hot dog water?
    Them was the dayz…

    ^^^Yea..i still try and keep it real here, these niggas soft now tho, bunch of Asher rothwalecharleshammy..niggas be tellin me to log off and don’t come back, postin pics to animated gifs..real Algernod shit.

  128. Da PartyStarter Says:

    Dude just wasn’t goin’ back. You’d be amazed at what you could do with a warrant out on you facin’ 3 strikes, an AK and a little motivation…

  129. b-ease Says:

    Big L > Jay-Z

    ^^
    Big Pun > Big L

  130. Danielson Says:

    Beezy Says:

    March 23rd, 2009 at 3:37 pm
    Big L > Jay-Z

    ^

    straight spittin, then yes, but i think only me and you like Big L up in here beezy. (n/h)

  131. Co!!inb: Magic City's Towel Boy Says:

    just remember in my city 50k is going gold
    -Rappin ass Degrasi nigga-

  132. sleep Says:

    is currency signed?

  133. I Hate My Job Says:

    What the fuck ya’ll talking, Hov invented metaphors

  134. A tribe called quest Says:

    Pun > Big L > Big > Jay-Z

    –Lets do a rorschach test, tell me what you see in this picture

    4.bp.blogspot.com/_XpzVbtlY8wE/STy3lSXgNQI/AAAAAAAAA7Y/FURM51sgwxc/s400/biggie-smalls.jpg

  135. Beezy Says:

    but i think only me and you like Big L up in here beezy. (n/h)

    ^Lots of fans, just no one who think he’s the GOAT like me.

    L blended everything perfectly…streets, lyrics, punchlines….

    “How come, you can listen to my first al-bum
    and tell where alot niggas got they whole style from…”

  136. AmpGeez a.k.a. Mr. Solo Dolo Says:

    Ok, for some reason my comments keep getting modded.

  137. Da PartyStarter Says:

    # I Hate My Job Says:
    March 23rd, 2009 at 3:40 pm

    What the fuck ya’ll talking, Hov invented metaphors

    ^^^^
    Hov single-handedly saved my second and fourth marriages AND taught me not to be ashamed of my body. (NH)

  138. Mic The Hand Tony Says:

    btw it appears that you’re only mad because people are co-signing me emphatically while you just keep making ad hominem attacks about my law degree. lol – as if i care.

    i wouldn’t have to put you in line if you had some humility but your comments are always phrased as if God has spoken so why reply with restraint when obviously your only goal is to have someone respond as i have. just giving you what you asked for [||]

    ^^That’s how you get your blog game poppin son..half these niggas you see come in here startin shit, gettin niggas riled up..is eskay and his wifey on two different comps in the same room.

    Sean Coonery = Mrs Ashmi

  139. Big_seth Says:

    # M.Tyson Says:
    ============================================
    by default if BIG would have done 2 or 3 more albums..that statement today would have been a joke real talk
    ^^

    But he didn’t so this is irrelevant. lol

  140. Danielson Says:

    not to me though. but again, it’s not that simple. I’m a music blogger, so when Soundscan’s come out, it behooves me to look at them and consider who sold what. but in a strictly personal sense, you niggas know I don’t fucking judge artists on their #’s like some of you fucking cowards on here. no shots.

    ^
    i dont judge by that, but im saying, you cant sit there and tell an artist or a record exec sales dont matter. to you and other fans, maybe not, but at the end of the day your lack of ‘judgement’ upon these rappers means shit to them, cos they ass getting dropped of they dont sell.

    thats my view on it anyway.

  141. eskay Says:

    >>eskay, your implication was that record sales mean “something” (and you’ve basically admitted as much in a subsequent comment) — otherwise why would u even set a bar for “the new gold” — why wouldn’t you just say gold is now irrelevant. but you didn’t say it was irrelevant – you just adjusted the metric. and now you’re saying it’s somewhat relevant for an artist putting food on the table. jury? what do you think?

    step your litigation game up. no, I did not imply that and you know this because I’m telling you that’s not what I implied. when you say “mean something” what exactly do you mean? that they mean something to me as a fan of hip-hop, to me as a music blogger and industry observer or do you mean that they are no longer relevant in the grand scheme of an artists career? because all of these have different answers, and none of them are black and white. you’re the one who brought up the whole “do sales matter” shit, not me, so you define it. If you wanna have a serious conversation about whether or not sales “matter” than we can have it. but you just seem like you wanna argue.

  142. sleep Says:

    If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want

  143. Johnny Cadelco Says:

    Now I can’t even capitalize MINUTE. What else can’t I not emphasize? I LOVE EM! btw Can’t for that white boys album.

  144. Johnny Cadelco Says:

    Can’t wait*

  145. Mic The Hand Tony Says:

    LF: I actually read a whole 400 plus comment post the other day..good ole days…

    Shout out to LL not the rapper, Kween of all Kweens.

  146. Young Tyrone Lazarus Jenkins the Fif aka YTLJ5 aka White Boy Swag, Black Boy Tags Says:

    Sean Coonery = Mrs Ashmi

    ^

    *retires*

    step your litigation game up.

    ^

    but why? i’m a corporate lawyer.

    If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want

    ^

    *jumps out of a window*

  147. b-ease Says:

    Now I can’t even capitalize MINUTE. What else can’t I not emphasize? I LOVE EM! btw Can’t for that white boys album.

    ^^
    You can do whatever you want dude. I just feel obligated to point it out when it sounds gay.

  148. Suaveebolaayatollahsaudiarabiacocacola Says:

    –Im glad terry is getting some shine as a lead actor. Dude is downright hilarious

    Terry killed that Vanessa Carlton joint in White Chicks.

  149. Danielson Says:

    big l is my fav rapper and a goat to me

    the only problem is his lack of commercial success is something i cannot defend and what others use to take his goat crown away.

    him and pun are the best i have ever heard spit, real talk.

  150. D. Billz Says:

    AmpGeez a.k.a. Mr. Solo Dolo Says:
    March 23rd, 2009 at 3:26 pm

    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    ^Smh. It was a punchline about jewelry for Pete’s sake.

    Jeses fuckin’ Christ.

  151. b-ease Says:

    If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want

    ^

    *jumps out of a window*

    ^^
    LOL

    But in all seriousness, does anyone know how much Padded Room sold?

  152. I Hate My Job Says:

    Jay-Z > Big L > Big Pun > Big

    Fixed

  153. eskay Says:

    furthermore chea, I don’t see not one person co-signing you emphatically and my word is the word of God nigga, you could never put me in line. FACT: i know far more and have thought far longer about how the music industry works than you have, so I could never ever lose this argument with you.

  154. A tribe called quest Says:

    I hated anyone getting into music to make money.

    Integrity > Cooning

    Yes i turned Coon into a verb, get over it

  155. D. Billz Says:

    *gets caught in illegitimate hustle*

    *does not hire chea as lawyer*

  156. green eyes Says:

    # b-ease Says:
    March 23rd, 2009 at 3:46 pm

    If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want

    ^

    *jumps out of a window*

    ^^
    LOL

    But in all seriousness, does anyone know how much Padded Room sold?

    ^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club

  157. Danielson Says:

    I Hate My Job Says:

    March 23rd, 2009 at 3:47 pm
    Jay-Z > Big L > Big Pun > Big

    Fixed

    ^
    woah woah woah, straight spittin, no one comes above pun and l.

  158. b-ease Says:

    Yes i turned Coon into a verb, get over it

    ^^
    *blank stare*

  159. PHENOMENON Says:

    # A tribe called quest Says:
    March 23rd, 2009 at 3:40 pm

    Pun > Big L > Big > Jay-Z

    –Lets do a rorschach test, tell me what you see in this picture

    4.bp.blogspot.com/_XpzVbtlY8wE/STy3lSXgNQI/AAAAAAAAA7Y/FURM51sgwxc/s400/biggie-smalls.jpg

    ^ ^
    Ok, Biggie after a trip to Burger King.

  160. Plug Says:

    40 MINUTES TO GO!!!!!!!!!!!!!!!!!!!!!!

  161. I Hate My Job Says:

    Hov single-handedly saved my second and fourth marriages AND taught me not to be ashamed of my body. (NH)
    *Joins Oakland SWAT*

  162. A tribe called quest Says:

    FACT: i know far more and have thought far longer about how the music industry works than you have, so I could never ever lose this argument with you.

    –*Throws flag*

    [Eskay is old as fuck joke here]

  163. Beezy Says:

    Padded Room did 12k, no?

    I didnt support, but I would’ve if it was better.

  164. Johnny Cadelco Says:

    You guys got it all wrong… It goes like this:

    2PAC > NAS > BIG > JAY-Z > BIG L > EMINEM.

  165. AmpGeez a.k.a. Mr. Solo Dolo Says:

    D. Billz Says:

    March 23rd, 2009 at 3:46 pm
    AmpGeez a.k.a. Mr. Solo Dolo Says:
    March 23rd, 2009 at 3:26 pm

    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    ^Smh. It was a punchline about jewelry for Pete’s sake.

    Jeses fuckin’ Christ.
    =======================================
    Dude needs to keep other MC’s names outta his mouth. He does this
    purposely to bait niggas. It’s some hoe shit, b.

  166. A tribe called quest Says:

    ^^
    *blank stare*

    –*Donates keyboard to salvation army*

  167. green eyes Says:

    # Johnny Cadelco Says:
    March 23rd, 2009 at 3:52 pm

    You guys got it all wrong… It goes like this:

    2PAC > NAS > BIG > JAY-Z > BIG L > EMINEM.

    ^ oh god

  168. duke Says:

    “suits” it’s ‘Rain Man’, dummies

  169. Jersey*made*me Says:

    D. Billz Says:

    March 23rd, 2009 at 3:46 pm
    AmpGeez a.k.a. Mr. Solo Dolo Says:
    March 23rd, 2009 at 3:26 pm

    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    ^Smh. It was a punchline about jewelry for Pete’s sake.

    Jeses fuckin’ Christ.

    ^^
    You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.

  170. D. Billz Says:

    # green eyes Says:
    March 23rd, 2009 at 3:48 pm

    # b-ease Says:
    March 23rd, 2009 at 3:46 pm

    If 20k is the new gold joe buddens still won’t go plat so manipulate the stats all u want

    ^

    *jumps out of a window*

    ^^
    LOL

    But in all seriousness, does anyone know how much Padded Room sold?

    ^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club

    ^Check, check, annnnnd… check.

  171. Plug Says:

    Saying Big > Jay is like saying Kobe> Jordan

    6 rings > 3 rings

  172. Mic The Hand Tony Says:

    ^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club

    ^^I thought I saw a video of TY buying out the whole store?

  173. D_Block_4_Life Says:

    Dude needs to keep other MC’s names outta his mouth. He does this
    purposely to bait niggas. It’s some hoe shit, b.
    ^^^
    So you basically just hate his whole existence right? I can respect that.

  174. A tribe called quest Says:

    Dude needs to keep other MC’s names outta his mouth. He does this
    purposely to bait niggas. It’s some hoe shit, b.

    –Yo fuck that, if you have a problem with someone why cant you say their name.

    Smh @ Holding your tongue.

  175. Big_seth Says:

    # green eyes Says:

    ^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club
    ^^

    I bought a DL too, so that’s like 5 right?

    lol

  176. Jersey*made*me Says:

    BTW

    *daps ALL in attendance*

  177. D. Billz Says:

    # Jersey*made*me Says:
    March 23rd, 2009 at 3:53 pm

    D. Billz Says:

    March 23rd, 2009 at 3:46 pm
    AmpGeez a.k.a. Mr. Solo Dolo Says:
    March 23rd, 2009 at 3:26 pm

    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    ^Smh. It was a punchline about jewelry for Pete’s sake.

    Jeses fuckin’ Christ.

    ^^
    You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.

    ^POW!

  178. Beezy Says:

    lol @ POW for some reason…. reminds me of 1970s Batman.

  179. D. Billz Says:

    # Mic The Hand Tony Says:
    March 23rd, 2009 at 3:54 pm

    ^ ty bigs bought a copy. rey did too. billz & i downloaded that shit… thats basically it for the NR beudden fan club

    ^^I thought I saw a video of TY buying out the whole store?

    ^*dies*

  180. nation Says:

    *expenses afternoon to chea’s lawfirm*

  181. I Hate My Job Says:

    Kobe = Jordan

  182. A tribe called quest Says:

    You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.

    –I told you, Amp = Joeys baby moms brother

  183. green eyes Says:

    # A tribe called quest Says:
    March 23rd, 2009 at 3:58 pm

    You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.

    –I told you, Amp = Joeys baby moms brother

  184. Mic The Hand Tony Says:

    I deleted Padded Room to make room for Thank You….Joe Budden music was better before the recession…now that we all sad and emo..its no fun to be like everyone else..I switched my game up..I’m on some happy shit now…Ijerk

  185. AmpGeez a.k.a. Mr. Solo Dolo Says:

    AmpGeez a.k.a. Mr. Solo Dolo Says:

    March 23rd, 2009 at 3:26 pm
    Joe Budden always saying some slick shit about somebody. I think he just dissed Juelz in his latest free. Dude comes off (Ayo!) like a hoe ass nigga. I’m waiting for some one to duff his punk ass out.

    Still like his music for the most part. No shots!
    ======================================
    My statement in it’s entierty. Why don’t y’all get off the man’s dick, like he does no wrong.

    Shits fucking disgusting, b.

  186. Danielson Says:

    nas is definitely not in my top 5, im sorry but after illmatic it was just downhill.

    pac would be last if it was lyrical skill and wordplay, out of the few goats i would mention but only because the others have come up with better rhymes.

    however pac is one of the most influential and most passionate rappers ever and i like how he repped black people in his songs, they even talked about him in congress, and no other rapper at the time was that influential.

  187. MiamiDaze Says:

    i like how he repped black people in his songs
    ______________

    I don’t know how to feel about that statement.

  188. AmpGeez a.k.a. Mr. Solo Dolo Says:

    green eyes Says:

    March 23rd, 2009 at 3:59 pm
    # A tribe called quest Says:
    March 23rd, 2009 at 3:58 pm

    You know how Amp feels about Joey.Lol.It’s borderline scorned womanish type hate.

    –I told you, Amp = Joeys baby moms brother
    ==============================
    Really? Fall back, big lips.

    I dig some of his stuff, but he does bitch ass shit. Just like Hov. Y’all act like the nigga is GOD or something.

  189. b-ease Says:

    nas is definitely not in my top 5, im sorry but after illmatic it was just downhill.

    ^^
    It Was Written is one of the greatest hiphop albums of all time. Lost Tapes was insane. Most people would say Stillmatic is a classic (not sure if i would tho), and Streets Disciple is underrated.

    So, no-sign.

  190. sleep Says:

    I’m copping a joe88 eventhough I never heard him ryhme. Who’s with me?

  191. eskay Says:

    chea’s either typing a dissertation in response to my ether, or he’s on the phone with his alma mater trying to re-book his first year curriculum.

  192. E.J. Says:

    Thank God these guys are out there again. I just got into an argument with a 14-year old about how fuckin stupid lil wayne is. This little muthafucka tried to me i was old (i’m 19) and that my old age was the reason why i didnt like lil wayne. Lil Wayne honestly reminds me of how i used to like limpbizkit. This nigga is the George Bush of music.

    ALL LIL WAYNE FANS ARE DUMBER THAN SARAH PALIN.

  193. Seth Gueko Says:

    maybe a eminem ft dr dre track
    and just a fiddy guest in da video

  194. sb Says:

    eskay Says:
    March 23rd, 2009 at 3:36 pm

    that said, Hov = GOAT

    ^^
    stoppp. god. just stop it. he’s so overrated it’s disgusting.

  195. E Says:

    He probably didn’t wear the suit cause there were only two guys in suits in Rain Man

  196. Chu Says:

    I don’t think it is Crack A Bottle, that was supposed to be animated. This is probably for his first official singled, rumored to be called “We Made You.”

  197. F Says:

    Those suits look very similar to Kanye’s suit in the promo for 808′s.

  198. Bomber Says:

    LOL 50 didnt fit in this picture at all, kinda sums up his career

  199. KiLLer Q-Kumber Says:

    ladies and gentlemen, PEE WEE HERMAN.

  200. hip-hop is dead Says:

    r u guyz fuckin retarded,

    BIG>JAY

    anyday

    Ready 2 Die>Reasonable DOubt
    Life After Death> Vol.1

  201. Matt Says:

    anyone know when this picture was shot??
    I was in Vegas this passed weekend and could have went to see it!

    saywhatsreal.com

  202. The Rap Up » Oh Great, Another Eminem Teaser Says:

    [...] a glass of Cpt. Morgan’s to Eskay] farkItButton(“Oh+Great%2C+Another+Eminem+Teaser”, [...]

  203. aroen Says:

    so this video is based off the movie “rainman”? dre as tom cruise, em as dustin hoffman, and fif is who? just fif? 3rd wheel status

Leave a Reply